circad | circRNAs associated with diseases

has_circ_0049220
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Systemic Lupus Erythematous	ICD-10	Drug-induced systemic lupus erythematosus (M32)
DBLink	Link to database	PMID	29606700
Experimental Method
Sample Type	Cells	Comparison	18 diagnosed SLE patients and 10 healthy controls
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CCAATTGTCTTGCGAACTATCGTA Reverse GTGCCATTGTAACGACTAACGCT	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Zhang, C, Huang, J, Chen, Y, Shi, W (2018). Low Expression and Clinical Value of hsa_circ_0049224 and has_circ_0049220 in Systemic Lupus Erythematous Patients. Med. Sci. Monit., 24:1930-1935.